ID: 1084840110_1084840114

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1084840110 1084840114
Species Human (GRCh38) Human (GRCh38)
Location 11:71839769-71839791 11:71839785-71839807
Sequence CCATATTCCCACTGTGGACACTG GACACTGCAATCCTAGCCAAGGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 4, 3: 23, 4: 244} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!