ID: 1084847458_1084847464

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1084847458 1084847464
Species Human (GRCh38) Human (GRCh38)
Location 11:71911652-71911674 11:71911683-71911705
Sequence CCTTCAAGTGCATGGAGCGTGAT AAGGGCCTATTGAACTCTGGGGG
Strand - +
Off-target summary {0: 16, 1: 20, 2: 13, 3: 22, 4: 77} {0: 28, 1: 27, 2: 19, 3: 18, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!