ID: 1085066401_1085066404

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1085066401 1085066404
Species Human (GRCh38) Human (GRCh38)
Location 11:73499238-73499260 11:73499252-73499274
Sequence CCCCGGCAAACTGCAGCAGCCCT AGCAGCCCTACCTACAGAAGAGG
Strand - +
Off-target summary {0: 7, 1: 169, 2: 234, 3: 438, 4: 550} {0: 1, 1: 0, 2: 1, 3: 8, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!