ID: 1085178532_1085178539

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1085178532 1085178539
Species Human (GRCh38) Human (GRCh38)
Location 11:74511699-74511721 11:74511741-74511763
Sequence CCACCCTGAAGGGGAGGACACAA CTGTTAATTGTAGAGCCCTAGGG
Strand - +
Off-target summary {0: 2, 1: 26, 2: 109, 3: 210, 4: 373} {0: 2, 1: 12, 2: 93, 3: 311, 4: 613}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!