|
Left Crispr |
Right Crispr |
| Crispr ID |
1085360569 |
1085360576 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:75881565-75881587
|
11:75881610-75881632
|
| Sequence |
CCTTAATGATTTTGGGGGCCCAA |
TTTTGCTATGTTGCCCTGGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 32, 2: 58, 3: 52, 4: 140} |
{0: 12, 1: 1055, 2: 16443, 3: 74197, 4: 171633} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|