ID: 1085480711_1085480719

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1085480711 1085480719
Species Human (GRCh38) Human (GRCh38)
Location 11:76820825-76820847 11:76820869-76820891
Sequence CCCTCCACGGTCTCCCTCTGATG CTGCTGTACTGCTGCCATCTCGG
Strand - +
Off-target summary {0: 87, 1: 19, 2: 6, 3: 18, 4: 219} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!