|
Left Crispr |
Right Crispr |
Crispr ID |
1085621569 |
1085621574 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
11:78041702-78041724
|
11:78041727-78041749
|
Sequence |
CCATCCACCACTGCTGTTTGCCA |
GACTCCCATCCCTCCGGATCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 41, 1: 78, 2: 97, 3: 99, 4: 296} |
{0: 8, 1: 33, 2: 113, 3: 105, 4: 157} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|