|
Left Crispr |
Right Crispr |
| Crispr ID |
1085747568 |
1085747572 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:79128211-79128233
|
11:79128250-79128272
|
| Sequence |
CCCTGGCATCTTCTGCAGATAAC |
GACAGCTCTTGGCCTGTTACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 203, 2: 161, 3: 142, 4: 220} |
{0: 162, 1: 189, 2: 129, 3: 114, 4: 178} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|