ID: 1086163523_1086163529

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1086163523 1086163529
Species Human (GRCh38) Human (GRCh38)
Location 11:83750154-83750176 11:83750170-83750192
Sequence CCCCAAGATTCCCATCTGAAGCA TGAAGCAGCTCACTGGCCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 214} {0: 1, 1: 0, 2: 0, 3: 20, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!