ID: 1086506768_1086506776

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1086506768 1086506776
Species Human (GRCh38) Human (GRCh38)
Location 11:87513273-87513295 11:87513307-87513329
Sequence CCCTGTATCAGTGCAGTATTTAG GGAAACACCCTGCCAGGCTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 25, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!