ID: 1086695075_1086695082

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1086695075 1086695082
Species Human (GRCh38) Human (GRCh38)
Location 11:89834514-89834536 11:89834538-89834560
Sequence CCATCTTTCCAAGGAGTTCTGGG TGGAATTTTTAAGGGGATTGTGG
Strand - +
Off-target summary No data {0: 3, 1: 5, 2: 13, 3: 55, 4: 313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!