ID: 1086726695_1086726697

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1086726695 1086726697
Species Human (GRCh38) Human (GRCh38)
Location 11:90194973-90194995 11:90194987-90195009
Sequence CCGAAATGATGTGGTAGTACTGG TAGTACTGGCAGTCGCTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 96} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!