ID: 1087276622_1087276631

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1087276622 1087276631
Species Human (GRCh38) Human (GRCh38)
Location 11:96167339-96167361 11:96167390-96167412
Sequence CCTAGCTGGCCTTCCTCCTGCCA CCTTCCACACTGGCCCCCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 553} {0: 1, 1: 0, 2: 2, 3: 38, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!