ID: 1087291577_1087291585

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1087291577 1087291585
Species Human (GRCh38) Human (GRCh38)
Location 11:96326457-96326479 11:96326507-96326529
Sequence CCTTCCTTCTTTCTTTTATATCC CGAGTTTAGGCTGGGTGCGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 26, 3: 403, 4: 3098} {0: 1, 1: 1, 2: 99, 3: 808, 4: 4897}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!