ID: 1087291578_1087291581

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1087291578 1087291581
Species Human (GRCh38) Human (GRCh38)
Location 11:96326461-96326483 11:96326494-96326516
Sequence CCTTCTTTCTTTTATATCCCTTT TTAAAAACTATCTCGAGTTTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 133, 4: 1597} {0: 1, 1: 0, 2: 0, 3: 17, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!