ID: 1087487142_1087487148

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1087487142 1087487148
Species Human (GRCh38) Human (GRCh38)
Location 11:98770712-98770734 11:98770727-98770749
Sequence CCAGCCTCGGCTCGGCATCAGAG CATCAGAGGGAGACCGTGGAGGG
Strand - +
Off-target summary No data {0: 87, 1: 19, 2: 6, 3: 18, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!