ID: 1087942694_1087942700

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1087942694 1087942700
Species Human (GRCh38) Human (GRCh38)
Location 11:104118252-104118274 11:104118274-104118296
Sequence CCCTCATGAATGGAATTAGTCCC CCTTATAAGAAGAGACACAAGGG
Strand - +
Off-target summary {0: 3, 1: 90, 2: 691, 3: 1539, 4: 2325} {0: 3, 1: 19, 2: 49, 3: 114, 4: 395}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!