ID: 1088715959_1088715964

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1088715959 1088715964
Species Human (GRCh38) Human (GRCh38)
Location 11:112549936-112549958 11:112549985-112550007
Sequence CCCAATTCTGTTTGTTCCAGTGA GATTCTTCCTCCTCTGGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 264} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!