ID: 1088879546_1088879550

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1088879546 1088879550
Species Human (GRCh38) Human (GRCh38)
Location 11:113962798-113962820 11:113962832-113962854
Sequence CCTCACTGAGCAGGGGAGATTTA AGGAGAGGGTATTTGCCAAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 16, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!