ID: 1088890261_1088890263

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1088890261 1088890263
Species Human (GRCh38) Human (GRCh38)
Location 11:114038485-114038507 11:114038520-114038542
Sequence CCAGACATTAGACTAGGCACCTT ATTAAAACTATACCAACTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 135} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!