ID: 1088890261_1088890265

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1088890261 1088890265
Species Human (GRCh38) Human (GRCh38)
Location 11:114038485-114038507 11:114038525-114038547
Sequence CCAGACATTAGACTAGGCACCTT AACTATACCAACTTTAGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 135} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!