ID: 1089195988_1089195999

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1089195988 1089195999
Species Human (GRCh38) Human (GRCh38)
Location 11:116694378-116694400 11:116694422-116694444
Sequence CCTGGGCCATCTTCTCCTCATCT TCCAAGAGGGCAGAGCCAAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 50, 4: 462} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!