ID: 1089496358_1089496369

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1089496358 1089496369
Species Human (GRCh38) Human (GRCh38)
Location 11:118910357-118910379 11:118910391-118910413
Sequence CCCTCACCCAGGGTGGGGTACCC CCCCCAGAGCGCTCCAGCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 513} {0: 1, 1: 0, 2: 1, 3: 24, 4: 607}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!