ID: 1089496363_1089496378

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1089496363 1089496378
Species Human (GRCh38) Human (GRCh38)
Location 11:118910378-118910400 11:118910403-118910425
Sequence CCCTCGTGCCCCACCCCCAGAGC TCCAGCCGTGGAGGGGGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 391} {0: 1, 1: 0, 2: 2, 3: 40, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!