ID: 1089496371_1089496384

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1089496371 1089496384
Species Human (GRCh38) Human (GRCh38)
Location 11:118910393-118910415 11:118910410-118910432
Sequence CCCAGAGCGCTCCAGCCGTGGAG GTGGAGGGGGCCCGGGGTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 136} {0: 1, 1: 0, 2: 1, 3: 80, 4: 708}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!