ID: 1089539155_1089539162

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1089539155 1089539162
Species Human (GRCh38) Human (GRCh38)
Location 11:119179662-119179684 11:119179691-119179713
Sequence CCACAGTGACTCTCCCCTGCTTC AGGTGGTTCCACGAGTGTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 384} {0: 1, 1: 0, 2: 0, 3: 1, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!