ID: 1089539160_1089539165

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1089539160 1089539165
Species Human (GRCh38) Human (GRCh38)
Location 11:119179677-119179699 11:119179701-119179723
Sequence CCTGCTTCTTTTTCAGGTGGTTC ACGAGTGTTTGGGCGCATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 201} {0: 1, 1: 0, 2: 0, 3: 2, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!