|
Left Crispr |
Right Crispr |
| Crispr ID |
1089763093 |
1089763094 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:120742914-120742936
|
11:120742930-120742952
|
| Sequence |
CCATGGAATACTGTGCAGCCATA |
AGCCATAAAAAGAATGAGATTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 435, 1: 25162, 2: 13854, 3: 8021, 4: 5374} |
{0: 2, 1: 5, 2: 10, 3: 48, 4: 438} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|