ID: 1089993485_1089993492

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1089993485 1089993492
Species Human (GRCh38) Human (GRCh38)
Location 11:122883064-122883086 11:122883085-122883107
Sequence CCACCCAAGCAAGCTGGGGAGGA GAGCCGGCGCGGGAGCCTTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 10, 4: 231} {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!