ID: 1089993486_1089993499

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1089993486 1089993499
Species Human (GRCh38) Human (GRCh38)
Location 11:122883067-122883089 11:122883106-122883128
Sequence CCCAAGCAAGCTGGGGAGGAGCC GGACGGAGTGGGGAGCGACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 218} {0: 1, 1: 0, 2: 0, 3: 20, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!