|
Left Crispr |
Right Crispr |
| Crispr ID |
1090221614 |
1090221617 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:125031575-125031597
|
11:125031613-125031635
|
| Sequence |
CCAGTAACAGGCTAAGAGCTGTC |
AGTTATCTGCAGAAGATGGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 170, 2: 192, 3: 145, 4: 175} |
{0: 185, 1: 187, 2: 104, 3: 111, 4: 225} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|