ID: 1090334197_1090334205

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1090334197 1090334205
Species Human (GRCh38) Human (GRCh38)
Location 11:125951787-125951809 11:125951807-125951829
Sequence CCATACTGAGCCATCATTCCTTC TTCCAGGGGAGCCTCTCGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 16, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!