ID: 1090780390_1090780405

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1090780390 1090780405
Species Human (GRCh38) Human (GRCh38)
Location 11:130002221-130002243 11:130002259-130002281
Sequence CCGCCGCCGGAGCGCGCAGGCCG GGCCCAACCAACGCGGGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 158} {0: 1, 1: 0, 2: 0, 3: 1, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!