ID: 1091004081_1091004089

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1091004081 1091004089
Species Human (GRCh38) Human (GRCh38)
Location 11:131936435-131936457 11:131936478-131936500
Sequence CCACTGGCCAAAAGGAACTTGTT TTGGAGACTCAGAAGGAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 216} {0: 3, 1: 21, 2: 121, 3: 266, 4: 675}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!