ID: 1091220526_1091220532

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1091220526 1091220532
Species Human (GRCh38) Human (GRCh38)
Location 11:133927644-133927666 11:133927679-133927701
Sequence CCTAAGGCCGTAAGGGTTGGAAG TGCATGGAGAGTAGGAAGACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60} {0: 1, 1: 0, 2: 0, 3: 23, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!