ID: 1091220528_1091220531

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1091220528 1091220531
Species Human (GRCh38) Human (GRCh38)
Location 11:133927651-133927673 11:133927678-133927700
Sequence CCGTAAGGGTTGGAAGAAGGTCA ATGCATGGAGAGTAGGAAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 112} {0: 1, 1: 0, 2: 3, 3: 48, 4: 568}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!