ID: 1091286949_1091286965

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1091286949 1091286965
Species Human (GRCh38) Human (GRCh38)
Location 11:134412845-134412867 11:134412878-134412900
Sequence CCCAGCCTCCCCTTCCGGGCCGG GTTCCGGAGAGAGGCCCGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 206} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!