ID: 1091373271_1091373279

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1091373271 1091373279
Species Human (GRCh38) Human (GRCh38)
Location 12:10687-10709 12:10733-10755
Sequence CCGCCCTCGCGGTGCTCTCCGGG CCGCCGGCGCAGGCGCAGAGAGG
Strand - +
Off-target summary No data {0: 2, 1: 164, 2: 62, 3: 71, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!