ID: 1091407202_1091407205

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1091407202 1091407205
Species Human (GRCh38) Human (GRCh38)
Location 12:216510-216532 12:216526-216548
Sequence CCCACTTGGTGTTCAGACTGGTT ACTGGTTAGTAAACCCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 3, 3: 15, 4: 111} {0: 1, 1: 2, 2: 1, 3: 5, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!