|
Left Crispr |
Right Crispr |
| Crispr ID |
1091427100 |
1091427105 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:400637-400659
|
12:400665-400687
|
| Sequence |
CCACAACATTTATGAATTAAGTT |
TCTTATATGGGCATGGTTCATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 2, 3: 27, 4: 313} |
{0: 18, 1: 64, 2: 156, 3: 308, 4: 528} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|