|
Left Crispr |
Right Crispr |
| Crispr ID |
1091454514 |
1091454520 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:596806-596828
|
12:596836-596858
|
| Sequence |
CCCAGCTACAGGAGGCTGAGGTG |
CACTTGAGCCCAGGAAGTCGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 16, 1: 30, 2: 124, 3: 296, 4: 733} |
{0: 105, 1: 1556, 2: 9133, 3: 32985, 4: 81448} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|