ID: 1091558671_1091558687

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1091558671 1091558687
Species Human (GRCh38) Human (GRCh38)
Location 12:1594423-1594445 12:1594467-1594489
Sequence CCCGCGCCGCCGCGCCCACGCCC TGCCGCCGCCGCTGCTCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 18, 3: 144, 4: 1101} {0: 1, 1: 0, 2: 3, 3: 33, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!