ID: 1091558677_1091558686

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1091558677 1091558686
Species Human (GRCh38) Human (GRCh38)
Location 12:1594443-1594465 12:1594466-1594488
Sequence CCCCCTGCCGCATCCTCCGCCTC CTGCCGCCGCCGCTGCTCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 115, 4: 1153} {0: 1, 1: 0, 2: 5, 3: 68, 4: 452}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!