ID: 1091558679_1091558697

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1091558679 1091558697
Species Human (GRCh38) Human (GRCh38)
Location 12:1594445-1594467 12:1594484-1594506
Sequence CCCTGCCGCATCCTCCGCCTCCT CGCGGGCCGGCGGGCGGCGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 86, 4: 1070} {0: 1, 1: 0, 2: 5, 3: 85, 4: 528}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!