ID: 1091558680_1091558704

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1091558680 1091558704
Species Human (GRCh38) Human (GRCh38)
Location 12:1594446-1594468 12:1594495-1594517
Sequence CCTGCCGCATCCTCCGCCTCCTG GGGCGGCGAGGGGGCCCCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 33, 3: 547, 4: 2432} {0: 1, 1: 1, 2: 9, 3: 94, 4: 661}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!