ID: 1091558681_1091558704

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1091558681 1091558704
Species Human (GRCh38) Human (GRCh38)
Location 12:1594450-1594472 12:1594495-1594517
Sequence CCGCATCCTCCGCCTCCTGCCGC GGGCGGCGAGGGGGCCCCGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 160, 4: 1581} {0: 1, 1: 1, 2: 9, 3: 94, 4: 661}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!