ID: 1091558682_1091558693

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1091558682 1091558693
Species Human (GRCh38) Human (GRCh38)
Location 12:1594456-1594478 12:1594475-1594497
Sequence CCTCCGCCTCCTGCCGCCGCCGC CCGCTGCTCCGCGGGCCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 66, 3: 331, 4: 1603} {0: 1, 1: 0, 2: 0, 3: 17, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!