ID: 1091558684_1091558708

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1091558684 1091558708
Species Human (GRCh38) Human (GRCh38)
Location 12:1594462-1594484 12:1594508-1594530
Sequence CCTCCTGCCGCCGCCGCTGCTCC GCCCCGGGGGCCGGGCGCACGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 34, 3: 167, 4: 1284} {0: 1, 1: 0, 2: 3, 3: 57, 4: 473}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!