ID: 1091558688_1091558713

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1091558688 1091558713
Species Human (GRCh38) Human (GRCh38)
Location 12:1594469-1594491 12:1594515-1594537
Sequence CCGCCGCCGCTGCTCCGCGGGCC GGGCCGGGCGCACGGGCTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 413} {0: 1, 1: 0, 2: 7, 3: 54, 4: 538}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!