ID: 1091558692_1091558702

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1091558692 1091558702
Species Human (GRCh38) Human (GRCh38)
Location 12:1594475-1594497 12:1594493-1594515
Sequence CCGCTGCTCCGCGGGCCGGCGGG GCGGGCGGCGAGGGGGCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 168} {0: 1, 1: 0, 2: 9, 3: 84, 4: 611}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!